Nelit7agealiffabutt Nelit7agealiffabutt
  • 29-01-2017
  • History
contestada

Name three sources of history?

Respuesta :

babyyxsam babyyxsam
  • 03-02-2017
Primary, Secondary, and Tertiary.
Answer Link

Otras preguntas

A force of 5000n is applied outwardly to each end of a 5. 0-m long rod with a radius of 34. 0 cm and a young's modulus of 125 × 108 n/m2. The elongation of the
it's not homework but can someone tell me if this printer is only for photos or it's just a normal printer​
PLZ HELP! 50 POINTS!!!! Which device is used to change a signal into a code?Group of answer choicesan encoderan antennaa wave
when the area of a circle is increasing twice as fast as the radius, the radius is given by
Elephants appear to have excellent __________ because they can remember large sections of their territory.
Kim needs 10 cups of apple juice for a recipe. How many quarts does she need?
using the letters from the word equation, how many 5-letter patterns can be formed in which q isfollowed immediately by u?
Fill in the missing numbers below. 5 feet + 12 inches = yard(s) inches = 1 foot + 1 yard feet = 3 feet + 24 inches
AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
If y ∝ 1∕x and y = –2 when x = 14, find the equation that connects x and y. A) y = –28x B) y = –7x C) y = –28∕x D) y = –7∕x