cdxxc3434 cdxxc3434
  • 27-12-2021
  • Biology
contestada

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Respuesta :

taylor11152
taylor11152 taylor11152
  • 27-12-2021

Answer:

look at explanation

Explanation:

basically in order to go from mrna to trna just replace

a becomes u

g becomes c

u becomes a

c becomes g

Answer Link

Otras preguntas

Plz i need help !! Is for tomorrow !!
In what range should your pulse rate be when you are jogging? What is the target range for a person 15 years old? 2) Why should you see a doctor before starti
A cube has a volume of 512, what is the area of one face of the cube?
2. During which dynasty did Menggu serve as an official? 3. How was Russia affected by Mongol rule? 4. What were some effects of the Indian Ocean trade? Boosted
Since the proper format for citing sources (whether in-text or as Works Cited) changes from time to time, A. be sure to research the current guidelines for you
why do all scientist use this system
list 5/8, 0.25, and 11/16 from least to greatest.
What is another word for a religious group?? ( other than church and denomination please)
How were slaves used by the maya and the Aztecs
Why do scientists use metric system for scientific measure?