pokediger1 pokediger1

26-11-2020
Social Studies

contestada

Who built some of the first roads in America?

private companies
England
Spain
public companies

Respuesta :

Hasqam2004 Hasqam2004

26-11-2020

Public companies is the correct answer with Henry McKinley being treated leader of his road construction company

Answer Link

Otras preguntas

The key financial consideration in choosing between private and 3pl distribution options is.

Which segments show changes of state that release heat? check all that apply. B–a c–b d–c e–d f–e.

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

What is the probability of getting an odd number on the first roll and less than 3 on the second roll? * choise 1/6 3/6 2/6 3/5

what is the word sad in french

Which is the BEST analysis of word choices used in this poem?A) In stanza two, the use of the words "dark corner", "dust", and "death" foreshadow the tragic end

Select the graph of the function f(x) = 4+ 1/x+6

What must students use when summarizing an informational text?

suppose y varies directly as x. suppose also that y=34 when x=17. find y when x=56.

why did truman get involved in the korean war?