lilmazeee lilmazeee
  • 29-09-2020
  • English
contestada

Why might a simple word work better than a “fancy” word in your ICE paragraph

Respuesta :

Аноним Аноним
  • 29-09-2020

A simple word may be a better choice because an ICE (Introduce, Cite and Explain your Evidence) article is only introducing to the reader. You do not want to make it too complicated, because then the reader will not understand what the article is saying.

Answer Link

Otras preguntas

Dave had a hard time _______ how much money he had spent on his vacation. giving back turning down working out setting aside
AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
who wrote how do i love thee let me count the ways
in the early twentieth century, what two experiments involving light and matter could not be explained by the wave theory of light?
1. Find the volume of the rectangular prism that has a height of 5 meters and the area of the base is 8m2.​
Which term or phrase represents a separation of charges in a molecule resulting in partial positive and partial negative charges.
arrange the compounds from lowest boiling point to highest boiling point.
Pam works a 52 hours in a week. Considering that a normal work week is 40 hours and paid at $1470 per hour and overtime is paid at time and a quarter What is he
I am confused, can someone help me
How much does it cost to fly a dog internationally