keppler keppler
  • 28-10-2014
  • English
contestada

In article "Mother Tongue" by Amy Tan, what does the title suggest?

Respuesta :

joanna201
joanna201 joanna201
  • 28-10-2014
"Mother tongue" usually refers to the original language a person speaks and is brought up to speak after he or she is born. 
Answer Link

Otras preguntas

what is 227.9 million km written in scientific notation
Dear Elizabeth I will be arriving in Brooklyn on Wednesday, July 15. I’m looking forward to seeing you. Love Aunt Sue Read the brief letter. Which revision i
_____ vestido es mio Choices : Ese Esto Esa Esta
A positive integer is 28 more than 3 times another. Their product is 580. Find the two integers
5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for the template strand.
3. [3.04] Describe a process for finding the measure of angle 2.
Geometry help please! Double points!
The water flowing over land is called ?
julio y yo (tocar) ir al teatro
Francois mowed 4 lawns in three hours at that rate how long would it take him to mow two lawns ?? Proportions plz help 14 points give right answer