BeautifulGirl43 BeautifulGirl43
  • 26-10-2018
  • Biology
contestada

5’ATGCCCGGGTGTCGTAGTTGA3’

Complete the complementary sequence for the template strand.

Respuesta :

Golu14
Golu14 Golu14
  • 04-11-2018

Answer for this question will be

3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand  will be 5'UACGGGCCCACAGCAUAACU 3'

Answer Link

Otras preguntas

how does a tree develop its thick bark
can u help me please be right this is a big assignment
Which of the following best describes the people to whom Roosevelt is referring
What would be the square root of 625 using the identity (a +b)2 = a2 + b2 + 2ab?
Im not really sure how to answer this
A block slides down a ramp with friction. The friction experienced by the block is 21 N. The mass of the block is 8 kg. The ramp is 6 meters long (meaning, t
Order these 1/4 0.4 1.4% 14/100 0.025
BEFORE equilibrium has been reached in this container: (Circle a letter for each) 1. Movement of glucose across the membrane in this container can best be descr
According to How the Other Half Lives, who was to blame for the lack of fresh air in buildings in the tenements
Find the sum of an infinite geometric series where a1 = 180, and the common ratio is r = 3∕4 ? Question 9 options: A) 240 B) 360 C) 135 D) 720