Samar89 Samar89

30-07-2015
Mathematics

contestada

is this right? isn't the Directly proportional equation this. x=(1/k)y

Respuesta :

30-07-2015

It's y=kx. But 'k' is any constant. So my 'k' can easily be 1/(your k). The key is that when 'x' or 'y' increases by some factor, the other one also increases, by some constant multiple of the same factor. If so, then they're proportional.

Answer Link

Otras preguntas

What is the mRNA sequence to match the DNA sequence below: TACGCTCCATATCGCTAATCGCCGGATCAGATT

When we think actively, we analyze different sides of an issue. True False

Three tickets to a concert cost $54. How much do 7 tickets cost? A. $58 B. $72 C. $108 D. $126

rachel jogged along a trail that was 1/4 of a mile long. She jogged along the trail 8 times. how many miles did rachel jog?

Football helmets are made with padding that helps reduce head injuries when a player collides with an object. Which best explains how the padding reduces injuri

What are the advantages to using exponential notation?

Simplify cosθ + sinθtanθ.

What is a moderate to vigorous for that a student can participate or not school without teammates? A)volleyball B)archery C)tennis D)baseball

_____ is the collective feelings of the population of an area; which may or may not have factual basis. Public opinion Propaganda Compromise Patriotism

many consonants silent today were pronounced in middle English. True or false?