urvimodi561 urvimodi561
  • 29-08-2022
  • Arts
contestada

Figure out these shapes?

Write answer below on all of the shapes, thanks:)

Figure out these shapes Write answer below on all of the shapes thanks class=

Respuesta :

vloneangelita
vloneangelita vloneangelita
  • 29-08-2022

Answer:

Organic and Geometric shapes!

Explanation:

ORGANIC: shapes, often curvilinear in appearance, that are similar to those found in nature, such as plants, animals, and rocks.

GEOMETRIC: any shapes and based on math principles, such as a square, circle, and triangle.

22. Organic

23. Geometric

24. Organic

25. Geometric

26. Looks more Geometric

27. Geometric

28. Organic

29. Organic

30. Looks more geometric

Answer Link

Otras preguntas

Approximately how many languages are officially recognized? A 6,800 B 7,800 C 8,800 D 9,800
Use the drop-down menus to complete the sentences. The rulers of the (blank) empire in southern India spoke Tamil. Indian cultural ideas and practices spread f
what is 1/4 of a circle?
Please help me on this question 15 POINTS
Radical functions are the inverse functions of exponential functions. A.true B.false
What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
Why is homeostasis important for cells as well as for an entire organism?
Aeolian string" refers to a harp-like instrument that plays when it is placed in the wind. Based on this definition, which statement best describes the speaker'
Which statement is FALSE regarding type 2 diabetes? A.Type 2 diabetes is usually found in adults. B.Type 2 diabetes always requires treatment with insulin.
what best describes the role of a tertiary consumer in a food web?