quieenmiyah quieenmiyah

30-06-2022
Spanish

contestada

Anoche mi primo yo__
la canción nueva de Shakira por primera vez.

Respuesta :

zarampa zarampa

30-06-2022

Answer:

escuchamos.

Explanation:

Anoche mi primo y yo escuchamos la canción nueva de Shkira por primera vez.

Answer Link

Otras preguntas

The most Frieda can afford to pay per year in mortgage payments is $10,400, and her credit score is currently 577. According to the following table for a $150,0

Bonds between amino acids are what type of bonds?

A cruise ship travels west at 25.0 m/s. John is taking his morning jog on the upper deck and jogs from the port side to the starboard side at 5 m/s. what 8s joh

if someone wanted to construct a new transcontinental railroad, what senate committee would most likely handle the request for congressional aide

plan to progress to become a music producer

which of these is an example of typing at an average of 42 words per minute

Humans raise large numbers of cattle for food. How will these herds of cows affect Earth's atmosphere?

You have a young patient with severe lordosis in the lumbar region. How would you explain to her why her leg often goes numb?

Consider the following mRNA strand: CCAUGGCAAAGGAGUGACUAA a. What DNA sequence would encode for this mRNA? Provide the sequence in form (single-or doublestrand

HELP QUICK!! WILL MARK BRAINY!!! Which transition is the best choice to complete the bolded sentence? Some people are born superstars, really! Michael Phelps, t