20100024120017
20100024120017 20100024120017
  • 28-08-2021
  • History
contestada

carry out hazard hunting of your home and identify types of hazard. suggest measures to mitigate it.​

Respuesta :

MRcheezelover
MRcheezelover MRcheezelover
  • 28-08-2021

[tex]\huge\underline\mathcal\red{Answer}[/tex]

Most Common Home Hazards and How to Prevent Them

  • Keep the floors dry to prevent any slipping, especially in the kitchen and bathrooms

  • Keep sturdy stepstools to use when reaching for things in closets or the top kitchen cabinets.

  • Use safety gates to close off staircases from wandering kids.

hope it helps

Answer Link

Otras preguntas

how many times larger is 5x(10 to the sixth power) than 5x (10 to the fourth power) ?
In the excerpt Cruel Tribute the sequence of events creates suspense by
how do I factor this completely
Addison has decided to learn transcendental meditation (tm). she will be given training in _____.​​
describe at least three different functions of proteins and explain how the shape of a protein affects its function
list the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
Can someone tell me what method I use for each one?
how are scouts fantasies about boo radley different?
Nationalism lead to the start of World War I because it caused
what two characteristics best describe indias climate