roselyndiaz29 roselyndiaz29
  • 27-08-2021
  • Mathematics
contestada

If someone could explain the error in depth and show step by step how to actually slove the problem that would be great.

If someone could explain the error in depth and show step by step how to actually slove the problem that would be great class=

Respuesta :

Sirious
Sirious Sirious
  • 27-08-2021

Step-by-step explanation:

The first step is wrong. It claims that

[tex]\frac{9x^3}{2x^3+9}=\frac{9x^{\cancel 3}}{2x^{\cancel 3}+9}=\frac{9}{2+9}[/tex]

but it is not true. It is attempting to simplify the fraction by cancelling the x^3 terms from 9x^3 and 2x^3.

However, to perform this operation, all terms in the fraction must be divided by x^3. But this will mean

[tex]\frac{9x^3}{2x^3+9}=\frac{(9)(x^3)}{(2+\textcolor{red}{\frac{9}{x^3}})(x^3)}=\frac{9}{2+\textcolor{red}{\frac{9}{x^3}}}[/tex]

Answer Link

Otras preguntas

The difference between the number of times the heart beats per minute at rest and during maximal exercise.
Yo muy simpatica. Ser or estar
What is the main religious text in Confucianism?
a bank loaned out $13,000 part of it at a rate of 8% per year and the rest at 16% per year. if the interest received in one year totaled $1500 how much was loan
{System: how do you make a website without paying for anything? This is for my computer class.}
Which of these power's is delegated to the federal government? A.Managing elections B.Taking land for public use C.Printing money D.Collecting taxes
Help with this question ✨
what is the mrna of tacgggcctatacgctactactggatc​
I visited an employment agency and my school counselor. To better understand job application forms. a. Fragment b. Run-on c. Correct
What the tenth term an=4n-1