Crystara16
Crystara16 Crystara16
  • 31-10-2016
  • English
contestada

Whom do we credit for discovering Mars?

Respuesta :

Noah11012
Noah11012 Noah11012
  • 31-10-2016
We do not exactly know who discovered Mars.
Answer Link

Otras preguntas

Solve by substitution X-2y= -2 Y=2x+4
what is the saying the texas western miners would score a victory for equality
What is the mRNA sequence to match the DNA sequence below: TACGCTCCATATCGCTAATCGCCGGATCAGATT
How often should you use deep, relaxing breathing techniques? a. Only when you've gotten enough sleep b. Every day c. Only during periods of stress d. No mo
In "Ooka and the Honest Thief," why doesn't Ooka immediately order Gonta to be punished? A. Ooka recognizes that Gonta isn't stealing for profit and trusts th
To check spelling, grammar, and sense in their work, careful writers utilize the process called _____. outlining drafting proofreading revising
Select all that apply. During meiosis II: genetic variation results from crossing over chromosomes line up along the middle plate in double file sister chroma
Which verbal expression represents the algebraic expression 3y?
Name the three methods by which heat can be transferred and give an example for each
how did the three steps of triangular trade network function