meggarcia meggarcia

29-09-2020
Chemistry

contestada

A scientific law only states that an event occurs true or false

Respuesta :

makalamoore25 makalamoore25

29-09-2020

Answer:

True a specific law only states that an event occurs.

Answer Link

Otras preguntas

One of the hiking trails at a state park is 14/3 miles long. Which mixed number shows the length of the hiking trail? A- 4 2/3 miles B- 4 1/3 miles C- 3 2/3 mil

Plz help me!!!!!!!!!!!!

HELP SPANISH EASYyyyyyyyy

Look at the graph. Based on the graph, in what year was the urban population of the United States roughly equal to the rural population? A )around 1795 B )arou

what is f(-8) equal to......Please correct

Which equation represents a line perpendicular to the line shown on the graph y=1/2x-2

Energy is released by the food organisms consume through the process of cellular respiration ____. during this process oxygen is consumed and ___(2 words)___ is

chemical equilibrium between gaseous reactants and products is shown. N2(g) + 3H2(g) ⇌ 2NH3(g) How will the reaction be affected if the pressure on the system

what is the mrna of tacgggcctatacgctactactggatc

a beekeeper estimates that his population of bees will triple each year. currently he has 150 bees. write a function to represent the growth of the beekeepers p