elizabethblanc127 elizabethblanc127

30-04-2020
Mathematics

contestada

Just 10, please not the other ones

Just 10 please not the other ones class=

Respuesta :

Аноним Аноним

30-04-2020

Answer:

28 km

Step-by-step explanation:

Take the radius, then divide it by pi, or 3.14.

Answer Link

Otras preguntas

The function f(x)=1/2x-6 was replaced with f(x+k)=1/2x-4. what is the value of k

he table gives the probability distribution of the number of books sold in a day at a bookstore. What is the probability of 16 or more books being sold on a giv

Two fair dice are rolled. what is the probability that both rolls will be a three?

It is a good idea to learn about a food supplier's warehouse practices. The best way to gather the information is to _______.

When sound waves travel from air to water what will happen to the speed at which they are moving?

Please help me with this question

Which color is absorbed and which is reflected by the leaves of most plants? Question options: Red and blue are absorbed; green is reflected. Blue and gre

The primary reason for completing medical records in a fashion consistent with medical staff policies and procedures is to:

How do daughter cells obtain their DNA? The DNA in the parent cell nucleus makes a copy of itself and is then split between the two daughter cells during mit

list the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT