Sinatra Sinatra

27-06-2016
English

contestada

An autobiography is a type of narrative nonfiction

Respuesta :

27-06-2016

You have not asked a question.

But, if you mean: "Is an autobiography a type of narrative non-fiction?"

the answer is 'Yes, it is.'

Answer Link

Otras preguntas

As the European powers grew more industrialized their colonies became very important as sources of

ellie uses 12.5 pounds of potatoesvto make mash potaatoes she uses one tenth as many pounds of butter hoe many pounds of butter does elllie uses

What type of current is produced by a battery? a. parallel current b. alternating current c. direct current d. potential current

. Which sentence best describes clustering? A. You're generating words that suggest possible sentences or paragraphs. B. You write down words or ideas in chron

DNA is typically found in cells in the form of a very long strand that is coiled many times and contains thousands or millions of nitrogen bases. Which term bes

what is 1 7/12 - 2 1/3 =

What is the mRNA sequence to match the DNA sequence below: TACGCTCCATATCGCTAATCGCCGGATCAGATT

Savannah has been diagnosed with panic attacks. She and her doctors are trying to figure out how to get her panic attacks under control. She is hooked up to a m

In the following sentence, what part of speech is the underlined phrase? Clothing worn by celebrities? can be sold at auction for crazy high prices. noun adje

The clause of the U.S. Constitution guarantees that birth certificates and marriage licenses are accepted from one state to another.