jadenword8 jadenword8
  • 31-10-2019
  • Mathematics
contestada

Equation for (-1,9) and (-0,-1)

Respuesta :

marquiswillis07
marquiswillis07 marquiswillis07
  • 31-10-2019

Answer:

I think it's 8

Step-by-step explanation:

you take away -1 because its the same

then you count units between 0 and 9

Answer Link

Otras preguntas

What is the mRNA sequence to match the DNA sequence below: TACGCTCCATATCGCTAATCGCCGGATCAGATT
(10-7)-(14-12) evalute
Describe completely how the Spanish organized the “La Flota” system.
Why did Spanish leaders want to push Spanish control into North America in the mid-1500s?      A. Spain decided to engage in the fur trade on a large s
which of these is a characteristic of a federal form of government A. free and fair elections B. a written constitution C. socialization through education D. la
Name an organelle that you see in the plant cell that you did not see in the animal cell.
How does the allele combination in parents affect the probability of recessive/dominant phenotypes produced in the offspring?
The degree of _____ relates directly to the source of power and control within an organization.
Why did the French concentrate their exploration in Canada?
A salesperson gets a 3% commission on the sale of a copy machine. What is his commission on a copy machine that costs $4,950.00?