fnafrocks
fnafrocks fnafrocks
  • 30-04-2019
  • Biology
contestada

What are the three things plants must be able to do

Respuesta :

johnlovesmath
johnlovesmath johnlovesmath
  • 30-04-2019

Answer:

While water, light and nutrients are essential to plant growth, plants also need other things in order to live. Air proves an essential part of plant growth and survival. Air provides plants with carbon dioxide. Like water and light, plants use carbon dioxide during photosynthesis

Explanation:

Answer Link
kaylee689
kaylee689 kaylee689
  • 30-04-2019

Grow , reproduce, and die or dry out

Answer Link

Otras preguntas

Read the excerpt from act ii, scene v of Romeo and Juliet. Friar Laurence : These violent delights have violent ends, and in their triumph die, like fire and po
describe Poe’s requirements for the short story genre.
Populations grow quickly when there is a __________ birth rate and a __________ death rate.
What do the carbon, oxygen, and nitrogen cycles all have in common
what is the mrna of tacgggcctatacgctactactggatc​
A flagpole casts a shadow that is 15 feet and a 5 feet teenager casts a shadow that is 6 feet. How tall is the flagpole? Use a drawing to help solve the problem
Angle R and Angle S are alternate exterior angles. Find the value of x if m
What does ababb mean
the BLANK Amendment is about BLANK in the presidency
please help with a) b) and c)