HecptyAura HecptyAura

30-09-2018
English

contestada

Is this a hyperbole?:
This test can be answered by a dog.

Respuesta :

Аноним Аноним

30-09-2018

Yes because a hyperbolye is an exaggerated statement or a claim not meant to be taken literally.

Good Luck:)

Klicker

Answer Link

laurencompton5418 laurencompton5418

30-09-2018

yes because it is an exaggeration

Answer Link

Otras preguntas

A survey of 120 middle schools showed that 30% have a foreign language program. How many schools have a foreign language program? Equation: Solution:

An ant is 2.0x10^-2 meters long.if you put 10 million ants in a line, how long is the line ? A.200 m B.2,000 m C.20,000 m D.200,000 m

Please help, I need these done today TT 1) Hilda is putting new tile in an area of her home. Part of the space is rectangular with a length of 10 feet and a wid

Why is it difficult to tap Siberia’s resources?

N^2-7n-8=0 solving quadratic equation.

what is the mrna of tacgggcctatacgctactactggatc

Which is one of the five characteristics of life

Toms Toy car went 2 meters without stopping Roberts went 145 centimeters whose car went farther

What are beats? A. periodic fluctuations in the velocity of sound waves B. periodic fluctuations in the wavelength of sound waves C. periodic fluctuations in th

Hi pls help me answer the question in the attachment, and explain why. Thanks!