apartmentsix020
apartmentsix020 apartmentsix020
  • 27-09-2018
  • Business
contestada

Which of the following is regulated by the FLSA? A. Affirmative action B. Health and safety procedures C. Labeling of food products D. Minimum wage

Respuesta :

vuhnill
vuhnill vuhnill
  • 27-09-2018

The FLSA regulates D) Minimum wage.

Answer Link
LearnGrow
LearnGrow LearnGrow
  • 21-11-2018

FLSA stands for The Fair Labor Standards Act.

FLSA regulates minimum wage. Correct answer: D Despite the minimum wage, the federal law FLSA regulates also overtime pay,  and child labor standards affecting full-time and part-time workers in the private sector and in Federal, State, and local governments.

Answer Link

Otras preguntas

Write the expression (6-8i)+(2+3i) as a complex number in standard form
Will give brainliest to correct answer
Equation for the point (2,25) in the form of f(x)=a^x
What serves as the best metric of your social marketing strategy? A. the number of unique visitors to your website B. the number of "hits" on your webpage C. th
which order pair is in the solution set of .5x-2y>3
P is the centroid of triangle MNO. MP=14x+8y. write expressions to represent PR and MR number 22 on sheet
What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
Li and Raj are playing football. They take turns trying to run past each other with the football. Li weighs 125 pound and Raj weighs 175 pounds. Li discovers th
Explain the geographic context for the use of coal to power industrialization in Great Britain in the late 1700s.
What is the outlined area called?