Jhen2549 Jhen2549
  • 28-05-2024
  • Medicine
contestada

If a dialysis patient is taking the drug class calcimimetic, which laboratory value shows that the drug is working as intended?
a. Increase in RBCs.
b. Decrease in platelet count.
c. Increase in serum phosphorus.
d. Reduction in serum calcium level

Respuesta :

Otras preguntas

What number divided by 9 equals 12
Quick! Help me with this! 8 points! (but don't answer until I have the image posted)
Which sentence has a dangling modifier? While walking along the beach, a huge wave almost swept away.
What is the adjective form of succeed
What is the mRNA sequence to match the DNA sequence below: TACGCTCCATATCGCTAATCGCCGGATCAGATT
79 over 100 as a percentage
Which characteristic of good leadership is missing when a president lies under oath? A. determination B. wisdom C. honesty D. integrity
"[D]eep as you are, my friend, you'll find it hard to plumb the plans of the everlasting gods." Who says this and why?
suppose you are adding 43 and 28 will you regroup?
If health care costs continue to rise, insurance companies fear that A. they'll have to offer a greater variety of insurance policies. B. consumers will be driv