chafincole chafincole

28-03-2024
Biology

contestada

CTGTTACTTTCAATCGTACACCAACACTGCTTTC
Translate and transcribe this strand of DNA into mRNA and amino acids.

Respuesta :

Otras preguntas

What caused two economic recessions in the United States during the late 1800s?

Do the ratios 2/1 and 18/10 form a proportion?

I will give brainliest to first person who answers this question.

READ : Menu Check-In: A Wrinkle in Time Chapter 4 What does Meg ask at the end of Chapter 4? O She asks why Calvin was brought along on this journey. O She asks

The amount y that a walrus eats is proportional to its weight x. A 4000 pound walrus eats 20 pounds each day. How much does a 2000 pound walrus eat each day?

Why did hitler start World war 2

Write a method largestDivisor that takes an integer argument and returns the largest positive integer which is less than the argument that divides the argument.

& Recommendations Skill plants Eureka Math - 7th grade > 5.8 Solve two-step equations: word problems D2Y Tutor Zack sold 3 of his old hockey sticks at Re

Can someone help me please?:)

There are 5000 books in the town's library. Of these, 4,000 are fiction. To find the percent of the books that are fiction, first set up the percent equation